Скачать PDF файл.

Формула / Реферат

Изобретение относится к области вирусологии, точнее - к молекулярной диагностике вирусных инфекций, и касается лабораторной диагностики вирусов гриппа типов A (Influenza virus А) и В (Influenza virus В) методом полимеразной цепной реакции (ПЦР).
Разработанной тест-системой для лабораторной диагностики гриппа А и гриппа В может проводится мультиплексная ПЦР (идентификация двух генных участков в одной реакции ПЦР). Мультиплексная ПЦР позволит выявлять вирусный материал в одной реакционной смеси, сократив время диагностики, процент финансовых затрат и технологических ошибок.
В качестве праймеров для проведения мультиплексной ПЦР, используются олигонуклеотиды InfAM68F GTTCCGTCAGGCCCCCTCAA и InfAM253R
ACGCTGCAGTCCTCGCTCAC, комплементарные не менее чем на 95% М гену вируса гриппа типа А и олигонуклеотиды InfBM26F TGTCGCTGTTTGGGAGACACA и InfBM293R GCTGTTGTTCCCATTCCTGA, комплементарные не менее чем на 95% М гену вируса гриппа типа В.
Размер фрагментов ДНК определяют относительно разделения маркера ДНК. Размер полученных фрагментов при гриппе A (Influenza virus А) должен соответствовать расчетному значению 185 пар нуклеотидов (п.н.), а при гриппе В (Influenza virus В) 267 п.н.
Диагностика вирусов гриппа типов А и В высокочувствительной и специфичной тест-системой на основе полимеразной цепной реакцией позволяет точно и очень быстро (~5 - 6 часов) выявлять РНК вирусов гриппа типов А и В из клинического материала. При этом возможно одновременное исследование большого количества проб.
Высокая специфичность метода ПЦР обусловлена тем, что в исследуемом материале выявляется уникальный, характерный только для вирусов гриппа типов А и В фрагменты кДНК. Специфичность задается нуклеотидной последовательностью праймеров, что исключает возможность получения ложных результатов в отличие от метода иммуноферментного анализа, где могут быть ошибки в связи с перекрестно-реагирующими антигенами.
14Порог чувствительности тест-системы для диагностики гриппа A (Influenza virus А) и гриппа В (Influenza virus В) на основе ПЦР набора составляет 1x102 копий РНК (0,1 пг) вирусов в пробе.
Разработанная тест-система для лабораторной диагностики гриппа A (Influenza virus А) и гриппа В (Influenza virus В) на основе ПЦР является специфичным и высокочувствительным.
15

Текст

Смотреть все

(51) 61 39/145 (2006.01) 12 15/10 (2006.01) КОМИТЕТ ПО ПРАВАМ ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ МИНИСТЕРСТВА ЮСТИЦИИ РЕСПУБЛИКИ КАЗАХСТАН, комплементарные не менее чем на 95 М гену вируса гриппа типа А и олигонуклеотиды 26 и 293, комплементарные не менее чем на 95 М гену вируса гриппа типа В. Размер фрагментов ДНК определяют относительно разделения маркера ДНК. Размер полученных фрагментов при гриппе(А) должен соответствовать расчетному значению 185 пар нуклеотидов (п.н.), а при гриппе В(В) 267 п.н. Диагностика вирусов гриппа типов А и В высокочувствительной и специфичной тестсистемой на основе полимеразной цепной реакцией позволяет точно и очень быстро (5 - 6 часов) выявлять РНК вирусов гриппа типов А и В из клинического материала. При этом возможно одновременное исследование большого количества проб. Высокая специфичность метода ПЦР обусловлена тем, что в исследуемом материале выявляется уникальный, характерный только для вирусов гриппа типов А и В фрагменты кДНК. Специфичность задается нуклеотидной последовательностью праймеров, что исключает возможность получения ложных результатов в отличие от метода иммуноферментного анализа, где могут быть ошибки в связи с перекрестнореагирующими антигенами. Порог чувствительности тест-системы для диагностики гриппа(А) и гриппа В(В) на основе ПЦР набора составляет 1102 копий РНК (0,1 пг) вирусов в пробе. Разработанная тест-система для лабораторной диагностики гриппа(А) и гриппа В(В) на основе ПЦР является специфичным и высокочувствительным.(72) Сансызбай Абылай Рысбай лы Султанкулова Куляйсан Турлыбаевна Сандыбаев Нурлан Тамамбаевич Хайруллин Берик Мухитович Строчков Виталий Михайлович Червякова Ольга Викторовна Орынбаев Мухит Бармакулы Шораева Камшат Абитхановна Бурашев Ербол Досанович(73) Республиканское государственное предприятие на праве хозяйственного ведения Научноисследовательский институт проблем биологической безопасности Комитета науки Министерства образования и науки Республики Казахстан(54) ТЕСТ-СИСТЕМА ДЛЯ ЛАБОРАТОРНОЙ ДИАГНОСТИКИ ГРИППА А И ГРИППА В МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ (ПЦР)(57) Изобретение относится к области вирусологии,точнее - к молекулярной диагностике вирусных инфекций, и касается лабораторной диагностики вирусов гриппа типов(А) и В(В) методом полимеразной цепной реакции (ПЦР). Разработанной тест-системой для лабораторной диагностики гриппа А и гриппа В может проводится мультиплексная ПЦР (идентификация двух генных участков в одной реакции ПЦР). Мультиплексная ПЦР позволит выявлять вирусный материал в одной реакционной смеси, сократив время диагностики,процент финансовых затрат и технологических ошибок. В качестве праймеров для проведения мультиплексной ПЦР,используются олигонуклеотиды 68 Изобретение относится к области вирусологии,точнее - к молекулярной диагностике вирусных инфекций, и касается лабораторной диагностики вирусов гриппа типов(А) и В(В) методом полимеразной цепной реакции(ПЦР),основанного на детекции генетического материала возбудителя,и предназначено для массовых анализов. Вирус гриппа типа А относится к семейству, широко распространен в природе,поражает многие виды млекопитающих и птиц, в основном водного и околоводного комплекса, и способен вызывать эпидемии, пандемии и эпизоотии ( ., 1998). Вирус гриппа А отличается высокой степенью вариабельности,особенно это касается поверхностных гликопротеинов вириона гемагглютинина (НА) и нейраминидазы . Известно 16 антигенных подтипов гемагглютинина (Н 1-Н 15) и 9 подтипов нейраминидазы (1-9). Вирус гриппа В также относится к семейству. Как и вирус гриппа А, способен изменять свою антигенную структуру. Однако эти процессы выражены менее четко, чем при гриппе типа А. Вирусы типа В не вызывают пандемию и обычно являются причиной локальных вспышек и эпидемий, иногда охватывающих одну или несколько стран. Вспышки гриппа типа В могут совпадать с таковыми гриппа типа А или предшествовать ему. Вирусы гриппа В циркулируют только в человеческой популяции, чаще вызывая заболевание у детей. Классическими методами диагностики данного возбудителя являются реакция торможения гемагглютинации,реакция связывания комплемента, реакция нейтрализации, позволяющие определять наличие вирусных антигенов, а также метод иммуноферментного анализа, позволяющий определять наличие антител к вирусным антигенам в сыворотках крови. Известна тест-система для лабораторной диагностики гриппа А и В методом полимеразной цепной реакции (ПЦР) Прототип 1. Прототип 1 ПЦР продукт, образующийся в результате амплификации генов М при гриппе(А) соответствует расчетному значению 352 пар нуклеотидов (п.н.), а при гриппе В(В) 444 п.н. Амплификацию проводят при температурно-временном режиме денатурация при 94 С-30 сек, отжиг при 55 С-30 сек, элонгация при 72 С-30 сек в течение 50 циклов. (. , .,-// . . 2003. - . 41- . 3487-3493). Известен способ диагностики вируса гриппа типов А и В с помощью метода полимеразной цепной реакции (ПЦР) Прототип 2 Прототип 2 ПЦР продукт, образующийся в результате амплификации генов М при гриппе составляют 190 п.н. и 241 п.н. соответственно. Амплификацию проводят при температурновременном режиме денатурация при 92 С - 1 мин,отжиг при 50 С - 2 мин, элонгация при 74 С - 2 мин в течение 40 циклов. ( , ,., . ., ВС// . . . 1992.-.-39.-. 1-13). Недостатком данных прототипов является то, что длительный временной режим значительно увеличивает время проведения исследований у прототипа 1 денатурация - 30 сек, отжиг - 30 сек,элонгация - 30 сек в течение 50 циклов и у прототипа 2 денатурация - 1 мин, отжиг- 2 мин,элонгация - 2 мин в течение 40 циклов. Нормативно-техническая документация,представляющая описание тест-системы ПЦР для определения РНК вируса гриппа, описывает способ диагностики,отличающийся от прототипов специфическими компонентами и методическими подходами. Целью настоящего изобретения являлось разработка тест-системы для лабораторной диагностики гриппа(А) и гриппа В(В) методом ПЦР. Техническим результатом изобретения является разработка тест-системы для лабораторной диагностики гриппа(А) и гриппа В(В) методом полимеразной цепной реакции (ПЦР). При этом разработанной тестсистемой для лабораторной диагностики гриппа А и гриппа В может проводится мультиплексная ПЦР(идентификация двух генных участков в одной реакции ПЦР). Мультиплексная ПЦР позволит выявлять вирусный материал в одной реакционной смеси, сократив время диагностики, процент финансовых затрат и технологических ошибок. Поставленная задача решается путем подбора пар олигонуклеотидных праймеров, специфичных для вирусов гриппа А и гриппа В. Для подбора специфичных праймеров на вирус гриппа А использовали нуклеотидные последовательности М генов различных подтипов. Для подбора специфичных праймеров на вирус гриппа В использовали также М гены различных штаммов вируса гриппа В. Последовательности были проанализированы с использованием комплекта программ.7.0. Подбор праймеров проводили с использованием программы Р 3. Уровень гомологии подобранных праймеров не менее чем 95. Сущность изобретения. Поставлена задача разработать тест-систему для лабораторной диагностики гриппа(А) и гриппа В(В) методом ПЦР на основе амплификации участка кДНК вирусов с помощью реакции обратной транскрипции и полимеразной цепной реакции участка М генов для увеличения количества копий ДНК вирусов гриппа А и гриппа В. Поставленная задача решается тем, что нужно составить комплекты реагентов для проведения различных этапов ПЦР-анализа, а именно для выделения вирусной РНК, синтеза кДНК,постановки ПЦР, проведения электрофореза в агарозном геле и анализа полученных электрофореграмм. При этом уровень гомологии подобранных праймеров составляет не менее 95 для обоих генов. Вирус выявляется, если после разделения части реакционной смеси в агарозном геле в анализируемом образце выявляются фрагменты ДНК размером 185 нуклеотидных пар для праймеров, специфичных вирусу гриппа А, и 267 нуклеотидных пар для праймеров, специфичных вирусу гриппа В. Основным критерием отбора олигонуклеотидов специфичных вирусу гриппа А и гриппа В являлось отсутствие гомологии с другими вирусами семейства и с другими возбудителями,вызывающими респираторные заболевания. Таким образом, для М генов вирусов гриппа А и гриппа В были подобраны пары праймеров, которые высококонсервативны и специфичны к своему типу и не имеют гомологии с другими типами вируса гриппа и с другими родственными вирусами. Рассчитанные олигонуклеотиды были синтезированы на автоматическом синтезаторе олигонуклеотидов 8909,(США) по стандартной методике. Диагностика вирусов гриппа типов А и В высокочувствительной и специфичной тестсистемой на основе полимеразной цепной реакцией позволяет точно и очень быстро (5-6 часов) выявлять РНК вирусов гриппа типов А и В из клинического материала. При этом возможно одновременное исследование большого количества проб. Также преимущество данной тест-системы заключается в том, что в качестве праймеров для проведения мультиплексной ПЦР, используются олигонуклеотиды 68, комплементарные не менее чем на 95 М гену вируса гриппа типа А и олигонуклеотиды 26 ТАСАСА и 293, комплементарные не менее чем на 95 М гену вируса гриппа типа В,выявление в анализируемых образцах продуктов ПЦР(фрагментов кДНК) размером 185 нуклеотидных пар при использовании праймеров,специфичных к гену М вируса гриппа типа А, и 267 нуклеотидных пар при использовании праймеров,специфичных к гену М вируса гриппа типа В,свидетельствует о наличии в исходном материале РНК вируса гриппа типов А и В. Описание сущности изобретения. Предлагаемая тест-система для лабораторной диагностики предусматривает выделение вирусной РНК, синтез кДНК, постановку ПЦР, проведение электрофореза в агарозном геле и анализ полученных электрофореграмм. В состав предложенной тест-системы входят четыре комплекта реагентов для проведения различных этапов ПЦР-анализа. Комплект реагентов 1 для выделения РНК состоит из следующих компонентов Раствор 1 (3,8 г гуанидин гидрохлорида, 0,5 мл твин 20, 3 мли 225 мгв 20 мл). Раствор 2 (3,8 г гуанидин гидрохлорида, 3 мл 1 и 225 мгв 20 мл). Раствор 3 (1,12 г , 2 мл 1 М трис-НС,8,0 доводят до 100 мл и 240 мл 96 этанола). РНК-элюент Хранение от 2 до 8 С. Комплект реагентов 2 для получения кДНК состоит из следующих компонентов Буфер для синтеза кДНК Раствор дНТФ 4 Смесь праймера для кДНК Ферментревертаза Деионизированная вода Хранение при минус 20 С. Комплект реагентов 3 для проведения ПЦР(амплификации участка кДНК) состоит из следующих компонентов Д полимераза Буфер для ПЦР 10 дНТФ Смесь праймеров для гриппа А и В Положительный контроль смесь кДНК вирусов гриппа типов А и В (ПК) Отрицательный контрольный образец (ОКО) Деионизированная вода Хранение при минус 20 С. Комплект реагентов 4 для электрофоретической детекции ПЦР продуктов Агароза 50 ТАЕ буфер для приготовления геля и проведения электрофореза Раствор бромистого этидия Срок хранения тест-системы 9 месяцев. Изобретение иллюстрируется следующими примерами. Пример 1. Выбор последовательности праймеров. Учитывая большую вариабельность генома вируса гриппа типа А, при его обнаружении необходимо использовать праймеры,соответствующие наиболее консервативным участкам вирусного генома. Основой для поиска мест отжига праймеров стало сопоставление нуклеотидных последовательностей М генов всех вирусов гриппа, представленных в международной базе данных. При выборе мест посадки праймеров учитывались следующие требования специфичность праймеров для всех последовательностей вирусов типа А и типа В,отсутствие мест отжига праймеров на последовательности вирусов других подтипов. Эта работа выполнялась с помощью программ 3, (версия 7.0). В качестве дополнительных критериев, определяющих пригодность праймеров,3 учитывались следующие отсутствие дуплексов праймеров и отжига их друг на друга, отсутствие мест ложного отжига на матрицы геномов различных штаммов вируса гриппа типов А и В, а также родственных вирусов. Этим критериям удовлетворяют все отобранные специфические праймеры на типы А и В. Специфические праймеры на вирус гриппа А 68 - 5- -3 253-53 Специфические праймеры на вирус гриппа В 26-5-ТАСАСА-3 293-53 Пример 2. Выделение РНК из образцов. 1. К 100 мкл исследуемого образца внести,используя наконечники с аэрозольным барьером по 100 мкл Раствора 1 (состав 3,8 г гуанидин гидрохлорида, 0,5 мл твин 20, 3 мл 1 и 225 мг хлорида натрия. Конечный объем раствора довести до 20 мл очищенной водой). 2. Тщательно перемешать, оставить на 10 минут при комнатной температуре. Затем на 1 час при 4 С. 3. Нагреть до комнатной температуры и пипетировать лизат для разрушения ДНК. Центрифугировать при 10500 , 10 мин. 4. К осадку добавить 500 мкл Раствора 2 (состав 3,8 г гуанидин гидрохлорида, 3 мл 1 и 225 мг хлорида натрия. Конечный объем раствора довести до 20 мл очищенной водой) и ресуспендировать вортексом (5 секунд). Затем центрифугировать 10000 , 10 мин. Супернатант удалить. 5. К осадку добавить 500 мкл промывочного Раствора 3(1,12 г хлористого натрия, 2 мл 1 М трисНС,8,0 объем раствора доводят до 100 мл и добавляют 240 мл 96 этанола), перемешать и вортекс 5 сек. Центрифугировать 10000 , 10 мин. Супернатант удалить. 6. Повторить п.5. 7. Удалить супернатант и сушить при 55 С 5 мин. К осадку добавить 50 мкл РНК-элюента и инкубировать 5 мин при комнатной температуре. РНК может храниться до 4 часов при 2-8 С. Для длительного хранения препарата необходимо минус 70 С. Пример 3. Синтез кДНК Реакцию обратной транскрипции проводят после получения РНК-пробы. В отдельной пробирке готовят общую реакционную смесь наобразцов. Реактивы вносят в последовательности, приведенной в таблице 1. Таблица 1 Реактивы для проведения обратной транскрипции Реактив Буфер для синтеза кДНК, 5 х дНТФ 4 Смесь праймеров для кДНК Ферментревертаза Вода Смесь перемешивают и раскапывают по 26 мкл в пробирки, затем в них вносят отдельным наконечником с фильтром по 4 мкл РНК соответствующих анализируемых или контрольных образцов. Подготовленную смесь обратной транскрипции инкубируют 10 мин при комнатной температуре, затем при температуре 42 С и инкубируют в течение 60 мин. Далее инкубируют при 94 С 2 мин. Синтезируемая кДНК хранится при минус 20 С продолжительное время. Пример 4. Проведение ПЦР с праймерами,специфичными к вирусу гриппа А и гриппа В (В) Постановку ПЦР проводили с кДНК образцов вируса гриппа(А) и гриппа В(В). Для постановки ПЦР использовали мультипраймерную систему,т.е. смесь специфических праймеров на типы А и В вируса гриппаМ 68 М 253 ВМ 26 ВМ 293 . В отдельной пробирке готовят общую реакционную смесь наобразцов, в число которых входят положительный и отрицательный контроли. Реактивы вносят в последовательности,приведенной в таблице 2. Фермент добавляют в последнюю очередь. Таблица 2 Реактивы для проведения ПЦР Реактив Буфер для ПЦР 10 дНТФ Смесь праймеров (20 рМ) ФерментДНК полимераза (5 Ед) Вода Смесь перемешивают и раскапывают по 48 мкл в пробирки, затем в них вносят отдельным наконечником с фильтром по 2 мкл кДНК соответствующих анализируемых или контрольных образцов (ПК и ОКО). Пробы вносят в амплификатор со следующим температурным режимом Пример 5. Детекция продуктов амплификации. Продукты амплификации разделяют в 1 агарозном геле в присутствии бромистого этидия. Результаты электрофореза просматривают в ультрафиолетовом свете с длиной волны 254 нм на приборе Трансиллюминатор. Результаты реакции выявляются в виде светящихся красноватых полос. Положительными считают пробы, полосы в которых располагаются в геле на уровне полосы положительного контроля. Исследуемые пробы считают отрицательными,если в них не выявлено никаких полос или полосы не соответствуют по размеру фрагменту в контрольной пробе (т.е. располагаются на другом расстоянии от старта). В отрицательном контроле не должно выявляться никаких полос. Присутствие в отрицательном контроле окрашенных фрагментов на уровне полос положительного контроля свидетельствует о перекрестной контаминации в процессе анализа. Результаты аннулируются. Анализ необходимо провести заново. Размер фрагментов ДНК определяют относительно разделения маркера ДНК. Размер полученных фрагментов при гриппе(А) должен соответствовать расчетному значению 185 пар нуклеотидов (п.н.), а при гриппе В(В) 267 п.н. Для определения специфичности ПЦР использовали вирусы. В качестве отрицательного контроля при определении специфичности ПЦР применили деионизированную воду. Полученные результаты представлены на фиг.1.(Вирусы гриппа типа А-1-9)1//07/2009 2 - //818/2009(11) 3-//830/2009(11) 4 - //01/2009(11) 5 - А/лошадь/От/764/07(38) 6 - А/лошадь/Киргизия/74(Н 77) 7 - А/утка/Павлодар/05/1 (51) 8 - А/ домашний гусь/ Павлодар/05(51) 9 - А/крачка/Южная Африка/61(35) (Вирусы гриппа типа В-10-12) 10 - В/Санкт- Петербург/03/09, линия 11 - В/Самара/97/08, линия 12 - В/ 60/2008, линия 13 - Аденовирус 14 - Энтеровирус 15 - Коронавирус 16 - Герпесвирус 17 - Вирус парагриппа - 3/Белорусский 18 - Энтеровирус 19 - Микоплазма 20 -21 - Герпесвирус 22 - С/ Ленинград/232/9/83 23 - С/Улан-Уде/34/86,24 - //1233/47 п.к. - положительный контроль - смесь кДНК вирусов гриппа типов А и В (АВ). Фиг.2 Электрофореграмма продуктов амплификации кДНК вирусов гриппа А (А) и гриппа В (В) и возбудителей,вызывающие респираторные заболевания При определении специфичности тест-системы для диагностики гриппа(А) и гриппа В (В) методом ПЦР было установлено, что во всех пробах, содержащих кДНК вируса гриппа(А) (пробы 1-9) нарабатывались специфические продукты реакции фрагменты ДНК размером 185 п.н., а в пробах,содержащих кДНК вируса гриппа В (В) (пробы 10-12) нарабатывались специфические продукты реакции - фрагменты ДНК размером 267 п.н. Отрицательные результаты были получены при использовании вирусов гриппа типа С, штаммов С/Ленинград/232/9/83 С/Улан-Уде/34/86//1233/47. Также отрицательные результаты были получены при использовании возбудителей,вызывающие респираторные заболевания. В качестве возбудителей, вызывающие респираторные заболевания использовали. Отсутствие каких-либо продуктов амплификации наблюдается и с деионизированной водой (ОК - отрицательный контроль). При определении чувствительности ПЦР тестсистемы использовали отработанные оптимальные температурно-временные условия реакции и были взяты 10-кратные разведения РНК вирусов гриппа РНК). Полученные результаты представлены на фиг.3 и 4. Фиг.3 - Определение чувствительности ПЦР при обнаружении РНК вируса гриппа типа А. М - Маркер 50 рИспользовали РНК вируса//818/2009(11) в следующих концентрациях 1 - 100 нг (1108 копий РНК) 2 - 10 нг (1107 копий РНК) 3 - 1 нг (1106 копий РНК) 4 - 100 пг (1105 копий РНК) 5 - 10 пг (1104 копий РНК) 6 - 1 пг (1103 копий РНК) 7 - 0,1 пг (1102 копий РНК) 8 - 0,01 пг(110 копий РНК). Фиг.4 - Определение чувствительности ПЦР при обнаружении РНК вируса гриппа типа В. М - Маркер 50 Использовали РНК вируса / 60/2008,линияв следующих концентрациях 1 - 100 нг (1108 копий РНК) 2 - 10 нг (1107 копий РНК) 3 - 1 нг (1106 копий РНК) 4 - 100 пг (1105 копий РНК) 5 - 10 пг (1104 копий РНК) 6 - 1 пг (1103 копий РНК) 7 - 0,1 пг (1102 копий РНК) 8 -0,01 пг(110 копий РНК). При оценке чувствительности тест-системы при тестировании 10-кратных разведении РНК вирусов гриппа(А) и гриппа В (В) от 100 нг (1108 копий РНК) до 0,01 пг(110 копий РНК) порог чувствительности составил 0,1 пг или 1102 копий РНК вирусов гриппа А и гриппа В. Разработанная тест-система для лабораторной диагностики гриппа(А) и гриппа В(В) на основе ПЦР является специфичным и высокочувствительным. ФОРМУЛА ИЗОБРЕТЕНИЯ Тест-система для лабораторной диагностики гриппа(А) и гриппа В (В) семействародаметодом ПЦР, предусматривающая выделение РНК, проведение реакции синтеза кДНК с РНК вируса, реакции амплификации, анализ реакционной смеси с помощью электрофореза в агарозном геле,отличающаяся тем, что в качестве праймеров для проведения мультиплексной ПЦР, используют олигонуклеотиды следующего состава 68253 на тип А 26293 на тип В.

МПК / Метки

МПК: C12N 15/10, A61K 39/145

Метки: цепной, полимеразной, вирус, пцр, реакции, тест-система, influenza, диагностики, лабораторной, методом, гриппа

Код ссылки

<a href="http://kzpatents.com/7-ip27607-test-sistema-dlya-laboratornojj-diagnostiki-grippa-a-influenza-virus-a-i-grippa-v-influenza-virus-b-metodom-polimeraznojj-cepnojj-reakcii-pcr.html" rel="bookmark" title="База патентов Казахстана">Тест-система для лабораторной диагностики гриппа А (influenza virus A) и гриппа В (Influenza virus B) методом полимеразной цепной реакции (ПЦР)</a>

Похожие патенты